Online Inquiry
Cttn cDNA ORF Clone, Mouse, C-HA tag
SPD-03801
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse cortactin with C terminal HA tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | Cortactin |
Gene Abbr. | Cttn |
Gene ID | 13043 |
Full Name | cortactin |
Alias | 1110020L01Rik, Ems, Ems1 |
Introduction | Cortactin is a cortical actin binding protein. Its amino-terminal acidic domain (NTA) associates with the Arp2/3 and WASP complex at F-actin branches. The central region of the protein contains six repeats of 37 amino acids that are important in F-actin binding and cross-linking. The carboxy-terminus contains a proline-rich region and an SH3 domain that can interact with numerous scaffolding proteins, such as CortBP1 and Shank3. Cortactin is involved in signaling events that coordinate actin reorganization during cell movement. The human cortactin homologue EMS1 is overexpressed in numerous cancers with poor patient prognosis. Cortactin may also play an important role in the organization of transmembrane receptors at postsynaptic densities (PSD) and tight junctions by linking scaffolding proteins to the actin network.Cortactin is phosphorylated at tyrosine residues 421, 466, and 482. Tyrosine phosphorylation of cortactin regulates cell motility rac1-mediated actin dynamics cadherin-dependent adhesion chemokine trafficking and chemokine-dependent chemotaxis. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse cortactin with C terminal HA tag. |
NCBI Ref Seq | NM_007803.5 |
RefSeq ORF Size | 1641 bp |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.