CTNNB1 Knockout Cell Line - CD BioSciences

service-banner

CTNNB1 Knockout Cell Line

CTNNB1 Knockout Cell Line

SPL-01076

Size Price
1 Unit Online Inquiry
Description
19bp deletion
Target Information
Target Name β-Catenin
Gene Abbr. CTNNB1
Gene ID 1499
Full Name catenin beta 1
Alias CTNNB, EVR7, MRD19, NEDSDV, armadillo
Species Human
Genomic Locus chr3:41225066
Transcript NM_001098210
WT Expression Level 140.94 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is part of a complex of proteins that constitute adherens junctions (AJs). AJs are necessary for the creation and maintenance of epithelial cell layers by regulating cell growth and adhesion between cells. The encoded protein also anchors the actin cytoskeleton and may be responsible for transmitting the contact inhibition signal that causes cells to stop dividing once the epithelial sheet is complete. Finally, this protein binds to the product of the APC gene, which is mutated in adenomatous polyposis of the colon. Mutations in this gene are a cause of colorectal cancer (CRC), pilomatrixoma (PTR), medulloblastoma (MDB), and ovarian cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 19bp deletion in a coding exon of CTNNB1.
Description 19bp deletion
Parental Cell Line C631
Guide RNA Sequence TCCCACTAATGTCCAGCGTT
PCR Primer Forward: GGTAAATGCTGAACTGTGGATAGTG
Reverse: CTCGTCATTTAGCAGTTTTGTCAGT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.