Online Inquiry
Ctnnb1 cDNA ORF Clone, Mouse, N-Myc tag
SPD-15788
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse catenin (cadherin associated protein), beta 1 with N terminal Myc tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | β-Catenin |
Gene Abbr. | Ctnnb1 |
Gene ID | 12387 |
Full Name | catenin (cadherin associated protein), beta 1 |
Alias | Bfc, Cat, Catnb, Mesc |
Introduction | β-Catenin is a key downstream effector in the Wnt signaling pathway. It is implicated in two major biological processes in vertebrates: early embryonic development and tumorigenesis. CK1 phosphorylates β-Catenin at Ser45. This phosphorylation event primes β-Catenin for subsequent phosphorylation by GSK-3β. GSK-3β destabilizes β-catenin by phosphorylating it at Ser33, Ser37, and Thr41. Mutations at these sites result in the stabilization of β-Catenin protein levels and have been found in many tumor cell lines.Lys49 lies in a region that contains several Ser/Thr residues whose phosphorylation status regulates the stability of β-catenin and is one of few residues frequently mutated in thyroid anaplastic carcinoma. CBP (CREB-binding protein) binds and acetylates β-catenin at Lys49. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse catenin (cadherin associated protein), beta 1 with N terminal Myc tag. |
NCBI Ref Seq | NM_007614.2 |
RefSeq ORF Size | 2346 bp |
Vector | pCMV3-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.