Ctnnb1 cDNA ORF Clone, Mouse, C-His tag - CD BioSciences

service-banner

Ctnnb1 cDNA ORF Clone, Mouse, C-His tag

Ctnnb1 cDNA ORF Clone, Mouse, C-His tag

SPD-15782

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse catenin (cadherin associated protein), beta 1 with C terminal His tag.
Target Information
Species Mouse
Target Name β-Catenin
Gene Abbr. Ctnnb1
Gene ID 12387
Full Name catenin (cadherin associated protein), beta 1
Alias Bfc, Cat, Catnb, Mesc
Introduction β-Catenin is a key downstream effector in the Wnt signaling pathway. It is implicated in two major biological processes in vertebrates: early embryonic development and tumorigenesis. CK1 phosphorylates β-Catenin at Ser45. This phosphorylation event primes β-Catenin for subsequent phosphorylation by GSK-3β. GSK-3β destabilizes β-catenin by phosphorylating it at Ser33, Ser37, and Thr41. Mutations at these sites result in the stabilization of β-Catenin protein levels and have been found in many tumor cell lines.Lys49 lies in a region that contains several Ser/Thr residues whose phosphorylation status regulates the stability of β-catenin and is one of few residues frequently mutated in thyroid anaplastic carcinoma. CBP (CREB-binding protein) binds and acetylates β-catenin at Lys49.
Product Details
Description Full length Clone DNA of Mouse catenin (cadherin associated protein), beta 1 with C terminal His tag.
NCBI Ref Seq NM_007614.2
RefSeq ORF Size 2391 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Restriction Sites KpnI + XbaI (6kb + 2.39kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.