CTNNB1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

CTNNB1 cDNA ORF Clone, Human, untagged

CTNNB1 cDNA ORF Clone, Human, untagged

SPD-15800

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human catenin (cadherin-associated protein), beta 1, 88kDa.
Target Information
Species Human
Target Name β-Catenin
Gene Abbr. CTNNB1
Gene ID 1499
Full Name catenin beta 1
Alias CTNNB, EVR7, MRD19, NEDSDV, armadillo
Introduction β-Catenin is a key downstream effector in the Wnt signaling pathway. It is implicated in two major biological processes in vertebrates: early embryonic development and tumorigenesis. CK1 phosphorylates β-Catenin at Ser45. This phosphorylation event primes β-Catenin for subsequent phosphorylation by GSK-3β. GSK-3β destabilizes β-catenin by phosphorylating it at Ser33, Ser37, and Thr41. Mutations at these sites result in the stabilization of β-Catenin protein levels and have been found in many tumor cell lines.Lys49 lies in a region that contains several Ser/Thr residues whose phosphorylation status regulates the stability of β-catenin and is one of few residues frequently mutated in thyroid anaplastic carcinoma. CBP (CREB-binding protein) binds and acetylates β-catenin at Lys49.
Product Details
Description Full length Clone DNA of Human catenin (cadherin-associated protein), beta 1, 88kDa.
NCBI Ref Seq NM_001098209.1
RefSeq ORF Size 2346 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 2.35kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.