Online Inquiry
CTNNA2 cDNA ORF Clone, Human, untagged
SPD-10608
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human catenin (cadherin-associated protein), alpha 2. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | N-Catenin |
| Gene Abbr. | CTNNA2 |
| Gene ID | 1496 |
| Full Name | catenin alpha 2 |
| Alias | CAP-R, CAPR, CDCBM9, CT114, CTNR |
| Introduction | Adherens junctions are dynamic structures that form cell-cell contacts and are important in development, differentiation, tissue integrity, morphology and cell polarity. They are composed of the transmembrane proteins, cadherins, which bind cadherins on adjacent cells in a calcium-dependent manner. On the cytoplasmic side of adherens junctions, the classic model states that cadherins are linked to the cytoskeleton through β- and α-catenin. α-E-catenin is ubiquitously expressed, α-N-catenin is expressed in neuronal tissue, and α-T-catenin is primarily expressed in heart tissue. Research studies have demonstrated that loss of E-cadherin and α-E-catenin occurs during the progression of several human cancers, indicating that the breakdown of adherens junctions is important in cancer progression.Research studies also suggest that, rather than acting as a static link between cadherins and actin, α-catenin regulates actin dynamics directly, possibly by competing with the actin nucleating arp2/3 complex. α-catenin also plays a role in regulating β-catenin-dependent transcriptional activity, affecting differentiation and response to Wnt signaling. α-catenin binds to β-catenin in the nucleus, preventing it from regulating transcription, and levels of both proteins appear to be regulated via proteasome-dependent degradation. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human catenin (cadherin-associated protein), alpha 2. |
| NCBI Ref Seq | NM_004389.3 |
| RefSeq ORF Size | 2718 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 705T/G, not causing the amino acid variation. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 2.72kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.