Ctnna1 cDNA ORF Clone, Mouse, C-HA tag - CD BioSciences

service-banner

Ctnna1 cDNA ORF Clone, Mouse, C-HA tag

Ctnna1 cDNA ORF Clone, Mouse, C-HA tag

SPD-04742

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse catenin (cadherin associated protein), alpha 1 with C terminal HA tag.
Target Information
Species Mouse
Target Name E-Catenin
Gene Abbr. Ctnna1
Gene ID 12385
Full Name catenin (cadherin associated protein), alpha 1
Alias 2010010M04Rik, AA517462, AI988031, Cat, Catna1
Introduction Adherens junctions are dynamic structures that form cell-cell contacts and are important in development, differentiation, tissue integrity, morphology and cell polarity. They are composed of the transmembrane proteins, cadherins, which bind cadherins on adjacent cells in a calcium-dependent manner. On the cytoplasmic side of adherens junctions, the classic model states that cadherins are linked to the cytoskeleton through β- and α-catenin. α-E-catenin is ubiquitously expressed, α-N-catenin is expressed in neuronal tissue, and α-T-catenin is primarily expressed in heart tissue. Research studies have demonstrated that loss of E-cadherin and α-E-catenin occurs during the progression of several human cancers, indicating that the breakdown of adherens junctions is important in cancer progression.Research studies also suggest that, rather than acting as a static link between cadherins and actin, α-catenin regulates actin dynamics directly, possibly by competing with the actin nucleating arp2/3 complex. α-catenin also plays a role in regulating β-catenin-dependent transcriptional activity, affecting differentiation and response to Wnt signaling. α-catenin binds to β-catenin in the nucleus, preventing it from regulating transcription, and levels of both proteins appear to be regulated via proteasome-dependent degradation.Phosphorylation of α-E-catenin has been shown to be a functionally important post-translational modification. For example, phosphorylation at Ser641 by casein kinase 2 modulates interactions between α-E-catenin and β-catenin. Mass spectrometry studies have identified phosphorylation of α-E-catenin at Ser652 as a modification in a variety of cell types (6-8), although the functional significance of this modification remains to be determined.
Product Details
Description Full length Clone DNA of Mouse catenin (cadherin associated protein), alpha 1 with C terminal HA tag.
NCBI Ref Seq NM_009818.1
RefSeq ORF Size 2721 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.