CTH Knockout Cell Line - CD BioSciences

service-banner

CTH Knockout Cell Line

CTH Knockout Cell Line

SPL-01073

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name CTH
Gene Abbr. CTH
Gene ID 1491
Full Name cystathionine gamma-lyase
Species Human
Genomic Locus chr1:70411552
Transcript NM_001902
WT Expression Level 25.30 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a cytoplasmic enzyme in the trans-sulfuration pathway that converts cystathione derived from methionine into cysteine. Glutathione synthesis in the liver is dependent upon the availability of cysteine. Mutations in this gene cause cystathioninuria. Alternative splicing of this gene results in three transcript variants encoding different isoforms. [provided by RefSeq, Jun 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of CTH.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence AGGCGCCCCTTGCTTGAACG
PCR Primer Forward: TTCGACTGGTTATATCTTCGGTGTT
Reverse: CATCTTTCGGTTGCCTTCCTAATTT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.