Online Inquiry
CTH Knockout Cell Line
SPL-01073
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | CTH |
| Gene Abbr. | CTH |
| Gene ID | 1491 |
| Full Name | cystathionine gamma-lyase |
| Species | Human |
| Genomic Locus | chr1:70411552 |
| Transcript | NM_001902 |
| WT Expression Level | 25.30 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a cytoplasmic enzyme in the trans-sulfuration pathway that converts cystathione derived from methionine into cysteine. Glutathione synthesis in the liver is dependent upon the availability of cysteine. Mutations in this gene cause cystathioninuria. Alternative splicing of this gene results in three transcript variants encoding different isoforms. [provided by RefSeq, Jun 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of CTH. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGGCGCCCCTTGCTTGAACG |
| PCR Primer |
Forward: TTCGACTGGTTATATCTTCGGTGTT Reverse: CATCTTTCGGTTGCCTTCCTAATTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.