Online Inquiry
CTDSP1 Knockout Cell Line
SPL-01067
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 325bp insertion |
| Target Information | |
|---|---|
| Target Name | CTDSP1 |
| Gene Abbr. | CTDSP1 |
| Gene ID | 58190 |
| Full Name | CTD small phosphatase 1 |
| Alias | NIF3, NLI-IF, NLIIF, SCP1 |
| Species | Human |
| Genomic Locus | chr2:218401627 |
| Transcript | NM_001206878 |
| WT Expression Level | 61.53 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the small C-terminal domain phosphatase (SCP) family of nuclear phosphatases. These proteins play a role in transcriptional regulation through specific dephosphorylation of phosphoserine 5 within tandem heptapeptide repeats of the C-terminal domain of RNA polymerase II. The encoded protein plays a role in neuronal gene silencing in non-neuronal cells, and may also inhibit osteoblast differentiation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 325bp insertion in a coding exon of CTDSP1. |
| Description | 325bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCTGTGTCTGCCGGGATGAT |
| PCR Primer |
Forward: CGTTTCAGAGAAAGTCAGGAGCTG Reverse: AAGTCCATCCTGAAAAGCTCAGTC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.