CTBP1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

CTBP1 cDNA ORF Clone, Human, untagged

CTBP1 cDNA ORF Clone, Human, untagged

SPD-04038

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human C-terminal binding protein 1.
Target Information
Species Human
Target Name CtBP1
Gene Abbr. CTBP1
Gene ID 1487
Full Name C-terminal binding protein 1
Alias BARS, HADDTS
Introduction CtBP1 (C-terminal binding protein 1) was first recognized as a cellular factor that interacts with the C-terminal portion of adenovirus E1A, a protein involved in the transcriptional regulation of key cellular genes. CtBP1 is able to regulate gene activity through its intrinsic dehydrogenase activity (2,3) and by interacting with Polycomb Group (PcG) proteins during development. Along with its homologue, CtBP2, it acts as a transcriptional corepressor of zinc-finger homeodomain factor deltaEF1 to regulate a wide range of cellular processes through transrepression mechanisms. Through its direct interaction with PRDM16, CtBP1 has been shown to be involved in brown adipose tissue differentiation by mediating the repression of white fat genes and directing differentiation toward the brown fat gene program. CtBP1 also plays a role in lipid metabolic pathways and membrane fission by regulating the fission machinery operating Golgi tubular networks. CtBP1 has recently been shown to repress transcription of BRCA1 via a redox regulated mechanism. Furthermore, it is thought that downregulation of BRCA1 and E-cadherin in invasive ductal breast carcinoma correlates directly with activation of CtBP1.
Product Details
Description Full length Clone DNA of Human C-terminal binding protein 1.
NCBI Ref Seq NM_001328.2
RefSeq ORF Size 1323 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + XbaI (6.1kb + 1.32kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.