Online Inquiry
CTBP1 cDNA ORF Clone, Human, C-FLAG tag
SPD-04037
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human C-terminal binding protein 1 |
Target Information | |
---|---|
Species | Human |
Target Name | CtBP1 |
Gene Abbr. | CTBP1 |
Gene ID | 1487 |
Full Name | C-terminal binding protein 1 |
Alias | BARS, HADDTS |
Introduction | CtBP1 (C-terminal binding protein 1) was first recognized as a cellular factor that interacts with the C-terminal portion of adenovirus E1A, a protein involved in the transcriptional regulation of key cellular genes. CtBP1 is able to regulate gene activity through its intrinsic dehydrogenase activity (2,3) and by interacting with Polycomb Group (PcG) proteins during development. Along with its homologue, CtBP2, it acts as a transcriptional corepressor of zinc-finger homeodomain factor deltaEF1 to regulate a wide range of cellular processes through transrepression mechanisms. Through its direct interaction with PRDM16, CtBP1 has been shown to be involved in brown adipose tissue differentiation by mediating the repression of white fat genes and directing differentiation toward the brown fat gene program. CtBP1 also plays a role in lipid metabolic pathways and membrane fission by regulating the fission machinery operating Golgi tubular networks. CtBP1 has recently been shown to repress transcription of BRCA1 via a redox regulated mechanism. Furthermore, it is thought that downregulation of BRCA1 and E-cadherin in invasive ductal breast carcinoma correlates directly with activation of CtBP1. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human C-terminal binding protein 1 |
NCBI Ref Seq | NM_001328.2 |
RefSeq ORF Size | 1362 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV mammalian cell promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | HindIII + NotI (6kb + 1.36kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.