Online Inquiry
CST3 Knockout Cell Line
SPL-01061
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 23bp deletion |
| Target Information | |
|---|---|
| Target Name | Cystatin C |
| Gene Abbr. | CST3 |
| Gene ID | 1471 |
| Full Name | cystatin C |
| Alias | ARMD11, HEL-S-2 |
| Species | Human |
| Genomic Locus | chr20:23637693 |
| Transcript | NM_000099 |
| WT Expression Level | 57.40 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes the most abundant extracellular inhibitor of cysteine proteases, which is found in high concentrations in biological fluids and is expressed in virtually all organs of the body. A mutation in this gene has been associated with amyloid angiopathy. Expression of this protein in vascular wall smooth muscle cells is severely reduced in both atherosclerotic and aneurysmal aortic lesions, establishing its role in vascular disease. In addition, this protein has been shown to have an antimicrobial function, inhibiting the replication of herpes simplex virus. Alternative splicing results in multiple transcript variants encoding a single protein. [provided by RefSeq, Nov 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 23bp deletion in a coding exon of CST3. |
| Description | 23bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CGTGCACTGGACTTTGCCGT |
| PCR Primer |
Forward: GACAGCGAAGACCGGGAAC Reverse: CGCGTCCTAGCCGACCAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.