Online Inquiry
CSRNP2 Knockout Cell Line
SPL-01060
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
34bp deletion |
Target Information | |
---|---|
Target Name | CSRNP2 |
Gene Abbr. | CSRNP2 |
Gene ID | 81566 |
Full Name | cysteine and serine rich nuclear protein 2 |
Alias | C12orf2, C12orf22, FAM130A1, PPP1R72, TAIP-12 |
Species | Human |
Genomic Locus | chr12:51073981 |
Transcript | NM_030809 |
WT Expression Level | 10.82 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene belongs to the CSRNP family of nuclear proteins that share conserved regions, including cysteine- and serine- rich regions, a basic domain, a transcriptional activation domain, and bind the sequence 'AGAGTG', thus have the hallmark of transcription factors. Studies in mice suggest that these genes may have redundant functions. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 34bp deletion in a coding exon of CSRNP2. |
Description | 34bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CACTGGTAAAACCTTGGCGC |
PCR Primer |
Forward: ACACTTAGGCACCTTCATTTTCTTG Reverse: ATCTCTCTGTGCTCCCTTCTCAG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.