CSNK1G1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

CSNK1G1 cDNA ORF Clone, Human, untagged

CSNK1G1 cDNA ORF Clone, Human, untagged

SPD-03498

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human casein kinase 1, gamma 1.
Target Information
Species Human
Target Name CK1
Gene Abbr. CSNK1G1
Gene ID 53944
Full Name casein kinase 1 gamma 1
Alias CK1gamma1
Product Details
Description Full length Clone DNA of Human casein kinase 1, gamma 1.
NCBI Ref Seq NM_022048.3
RefSeq ORF Size 1269 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.27kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.