Online Inquiry
CSNK1E Knockout Cell Line
SPL-01055
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 13bp deletion |
| Target Information | |
|---|---|
| Target Name | CK1 |
| Gene Abbr. | CSNK1E |
| Gene ID | 1454 |
| Full Name | casein kinase 1 epsilon |
| Alias | CKIe, CKIepsilon, HCKIE |
| Species | Human |
| Genomic Locus | chr22:38314113 |
| Transcript | NM_152221 |
| WT Expression Level | 104.49 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a serine/threonine protein kinase and a member of the casein kinase I protein family, whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein is found in the cytoplasm as a monomer and can phosphorylate a variety of proteins, including itself. This protein has been shown to phosphorylate period, a circadian rhythm protein. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of CSNK1E. |
| Description | 13bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ACCGCCTGGGACGGAAGATC |
| PCR Primer |
Forward: TTCGAGAATGCAGGTTTTCGAGTTC Reverse: ACATTCTGACTTCAGATCCCCAAAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.