Online Inquiry
Csnk1e cDNA ORF Clone, Mouse, N-Myc tag
SPD-03476
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse casein kinase 1, epsilon with N terminal Myc tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | CK1 |
Gene Abbr. | Csnk1e |
Gene ID | 27373 |
Full Name | casein kinase 1, epsilon |
Alias | AI426939, AI551861, AW457082, CK1e, CK1epsilon |
Introduction | Casein Kinase I (CK1 or CKI) is the name given to a family of kinases consisting of multiple isoforms (α, α', β, γ1-3, δ, and ε) with a conserved N-terminal kinase domain and a variable C-terminal sequence that determines subcellular localization and regulates enzyme activity. Indeed, multiple inhibitory autophosphorylation sites have been identified near the C terminus of CK1ε. This ubiquitously expressed family of protein kinases has been implicated in multiple processes including DNA repair, cell morphology, and Wnt signaling. Perhaps the best understood role of CK1 is to provide the priming phosphorylation of β-catenin at Ser45 to produce the consensus GSK-3 substrate motif (S/T-X-X-X-pS).CK1ε is involved in many cellular processes such as differentiation, cell growth and , and control of the circadian rhythm. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse casein kinase 1, epsilon with N terminal Myc tag. |
NCBI Ref Seq | NM_013767.6 |
RefSeq ORF Size | 1251 bp |
Vector | pCMV3-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.