CSNK1E cDNA ORF Clone, Human, N-Myc tag - CD BioSciences

service-banner

CSNK1E cDNA ORF Clone, Human, N-Myc tag

CSNK1E cDNA ORF Clone, Human, N-Myc tag

SPD-03486

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human casein kinase 1, epsilon with N terminal Myc tag.
Target Information
Species Human
Target Name CK1
Gene Abbr. CSNK1E
Gene ID 1454
Full Name casein kinase 1 epsilon
Alias CKIe, CKIepsilon, HCKIE
Introduction Casein Kinase I (CK1 or CKI) is the name given to a family of kinases consisting of multiple isoforms (α, α', β, γ1-3, δ, and ε) with a conserved N-terminal kinase domain and a variable C-terminal sequence that determines subcellular localization and regulates enzyme activity. Indeed, multiple inhibitory autophosphorylation sites have been identified near the C terminus of CK1ε. This ubiquitously expressed family of protein kinases has been implicated in multiple processes including DNA repair, cell morphology, and Wnt signaling. Perhaps the best understood role of CK1 is to provide the priming phosphorylation of β-catenin at Ser45 to produce the consensus GSK-3 substrate motif (S/T-X-X-X-pS).CK1ε is involved in many cellular processes such as differentiation, cell growth and , and control of the circadian rhythm.
Product Details
Description Full length Clone DNA of Human casein kinase 1, epsilon with N terminal Myc tag.
NCBI Ref Seq NM_001894.4
RefSeq ORF Size 1251 bp
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.