CSNK1D Knockout Cell Line - CD BioSciences

service-banner

CSNK1D Knockout Cell Line

CSNK1D Knockout Cell Line

SPL-01053

Size Price
1 Unit Online Inquiry
Description
10bp deletion
Target Information
Target Name CK1
Gene Abbr. CSNK1D
Gene ID 1453
Full Name casein kinase 1 delta
Alias ASPS, CKI-delta, CKId, CKIdelta, FASPS2
Species Human
Genomic Locus chr17:82253063
Transcript NM_139062
WT Expression Level 95.51 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene is a member of the casein kinase I (CKI) gene family whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein may also be involved in the regulation of apoptosis, circadian rhythm, microtubule dynamics, chromosome segregation, and p53-mediated effects on growth. The encoded protein is highly similar to the mouse and rat CK1 delta homologs. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of CSNK1D.
Description 10bp deletion
Parental Cell Line C631
Guide RNA Sequence AGGTTCTTGTTCTCACGATA
PCR Primer Forward: TGACTCAGAAATGTCCCAGCATC
Reverse: TTCATTCAAAGAACTTCATCCACCG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.