CSNK1D cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

CSNK1D cDNA ORF Clone, Human, untagged

CSNK1D cDNA ORF Clone, Human, untagged

SPD-03468

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human casein kinase 1 delta.
Target Information
Species Human
Target Name CK1
Gene Abbr. CSNK1D
Gene ID 1453
Full Name casein kinase 1 delta
Alias ASPS, CKI-delta, CKId, CKIdelta, FASPS2
Introduction Casein Kinase I (CK1 or CKI) is the name given to a family of kinases consisting of multiple isoforms (α, α', β, γ1-3, δ, and ε) with a conserved N-terminal kinase domain and a variable C-terminal sequence that determines subcellular localization and regulates enzyme activity. Indeed, multiple inhibitory autophosphorylation sites have been identified near the C terminus of CK1ε. This ubiquitously expressed family of protein kinases has been implicated in multiple processes including DNA repair, cell morphology, and Wnt signaling. Perhaps the best understood role of CK1 is to provide the priming phosphorylation of β-catenin at Ser45 to produce the consensus GSK-3 substrate motif (S/T-X-X-X-pS).CK1δ is involved in many cellular processes such as differentiation cell growth and apoptosis, and control of the circadian rhythm.
Product Details
Description Full length Clone DNA of Human casein kinase 1 delta.
NCBI Ref Seq NM_139062.1
RefSeq ORF Size 1230 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites NheI + XbaI (6.1kb + 1.23kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.

We use cookies to understand how you use our site and to improve the overall user experience. This includes personalizing content and advertising. Read our Privacy Policy

Accept Cookies
x