Online Inquiry
CSNK1D cDNA ORF Clone, Human, N-His tag
SPD-03465
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human casein kinase 1 delta with N terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | CK1 |
Gene Abbr. | CSNK1D |
Gene ID | 1453 |
Full Name | casein kinase 1 delta |
Alias | ASPS, CKI-delta, CKId, CKIdelta, FASPS2 |
Introduction | Casein Kinase I (CK1 or CKI) is the name given to a family of kinases consisting of multiple isoforms (α, α', β, γ1-3, δ, and ε) with a conserved N-terminal kinase domain and a variable C-terminal sequence that determines subcellular localization and regulates enzyme activity. Indeed, multiple inhibitory autophosphorylation sites have been identified near the C terminus of CK1ε. This ubiquitously expressed family of protein kinases has been implicated in multiple processes including DNA repair, cell morphology, and Wnt signaling. Perhaps the best understood role of CK1 is to provide the priming phosphorylation of β-catenin at Ser45 to produce the consensus GSK-3 substrate motif (S/T-X-X-X-pS).CK1δ is involved in many cellular processes such as differentiation cell growth and apoptosis, and control of the circadian rhythm. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human casein kinase 1 delta with N terminal His tag. |
NCBI Ref Seq | NM_139062.1 |
RefSeq ORF Size | 1275 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Restriction Sites | KpnI (two restriction sites) + XbaI (6kb + 0.07kb + 1.21kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.