Online Inquiry
Csnk1a1 cDNA ORF Clone, Mouse, N-FLAG tag
SPD-03433
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse casein kinase 1, alpha 1 with N terminal Flag tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | CK1 |
Gene Abbr. | Csnk1a1 |
Gene ID | 93687 |
Full Name | casein kinase 1, alpha 1 |
Alias | 2610208K14Rik, 4632404G05Rik, 5430427P18Rik, CK1a, Csnk1a |
Introduction | Casein Kinase I (CK1 or CKI) is the name given to a family of kinases consisting of multiple isoforms (α, α', β, γ1-3, δ, and ε) with a conserved N-terminal kinase domain and a variable C-terminal sequence that determines subcellular localization and regulates enzyme activity. Indeed, multiple inhibitory autophosphorylation sites have been identified near the C terminus of CK1ε. This ubiquitously expressed family of protein kinases has been implicated in multiple processes including DNA repair, cell morphology, and Wnt signaling. Perhaps the best understood role of CK1 is to provide the priming phosphorylation of β-catenin at Ser45 to produce the consensus GSK-3 substrate motif (S/T-X-X-X-pS). |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse casein kinase 1, alpha 1 with N terminal Flag tag. |
NCBI Ref Seq | NM_146087.2 |
RefSeq ORF Size | 978 bp |
Vector | pCMV3-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.