Csnk1a1 cDNA ORF Clone, Mouse, C-HA tag - CD BioSciences

service-banner

Csnk1a1 cDNA ORF Clone, Mouse, C-HA tag

Csnk1a1 cDNA ORF Clone, Mouse, C-HA tag

SPD-03431

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse casein kinase 1, alpha 1 with C terminal HA tag.
Target Information
Species Mouse
Target Name CK1
Gene Abbr. Csnk1a1
Gene ID 93687
Full Name casein kinase 1, alpha 1
Alias 2610208K14Rik, 4632404G05Rik, 5430427P18Rik, CK1a, Csnk1a
Introduction Casein Kinase I (CK1 or CKI) is the name given to a family of kinases consisting of multiple isoforms (α, α', β, γ1-3, δ, and ε) with a conserved N-terminal kinase domain and a variable C-terminal sequence that determines subcellular localization and regulates enzyme activity. Indeed, multiple inhibitory autophosphorylation sites have been identified near the C terminus of CK1ε. This ubiquitously expressed family of protein kinases has been implicated in multiple processes including DNA repair, cell morphology, and Wnt signaling. Perhaps the best understood role of CK1 is to provide the priming phosphorylation of β-catenin at Ser45 to produce the consensus GSK-3 substrate motif (S/T-X-X-X-pS).
Product Details
Description Full length Clone DNA of Mouse casein kinase 1, alpha 1 with C terminal HA tag.
NCBI Ref Seq NM_146087.2
RefSeq ORF Size 978 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.