Csk cDNA ORF Clone, Mouse, C-Myc tag - CD BioSciences

service-banner

Csk cDNA ORF Clone, Mouse, C-Myc tag

Csk cDNA ORF Clone, Mouse, C-Myc tag

SPD-04007

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse c-src tyrosine kinase with C terminal Myc tag.
Target Information
Species Mouse
Target Name Csk
Gene Abbr. Csk
Gene ID 12988
Full Name c-src tyrosine kinase
Alias AW212630, p50CSK
Introduction Carboxy-terminal Src kinase (Csk) is a ubiquitously expressed nonreceptor tyrosine kinase that negatively regulates the Src family kinases (SFKs) by phosphorylation of the SFK carboxy-terminal tyrosine. Phosphorylated carboxy-terminal tyrosine binds to the SH2 domain of SFK intramolecularly and leads to folding and inactivation of the SFK. This Csk-catalyzed SFK tyrosine phosphorylation is highly specific and exclusive. The SFK carboxy-terminal tyrosine is the only known physiological substrate of Csk.Csk consists of an SH2, an SH3, and a kinase domain. There is evidence that the SH2 and SH3 domains are essential for the regulation of SFK, and Csk can be recruited to the membrane where SFKs are in an active state. This process is mediated by a Csk-binding protein (Cbp, also called PAG), which binds tightly to the SH2 domain of Csk. Activation of SFK by extracellular stimuli leads to the tyrosine phosphorylation of Cbp, generating docking sites for Csk. The recruitment of Csk forms a feedback mechanism for termination of SFK function.
Product Details
Description Full length Clone DNA of Mouse c-src tyrosine kinase with C terminal Myc tag.
NCBI Ref Seq NM_007783.2
RefSeq ORF Size 1353 bp
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.