Online Inquiry
CSF3R cDNA ORF Clone, Human, C-Myc tag
SPD-06065
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human colony stimulating factor 3 receptor (granulocyte), transcript variant 1 with C terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | G-CSF Receptor |
Gene Abbr. | CSF3R |
Gene ID | 1441 |
Full Name | colony stimulating factor 3 receptor |
Alias | CD114, GCSFR, SCN7 |
Introduction | The protein encoded by this gene is the receptor for colony stimulating factor 3, a cytokine that controls the production, differentiation, and function of granulocytes. The encoded protein, which is a member of the family of cytokine receptors, may also function in some cell surface adhesion or recognition processes. Four transcript variants encoding four different isoforms have been found for this gene, with three of the isoforms being membrane-bound and the other being secreted and soluble. Mutations in this gene are a cause of Kostmann syndrome, also known as severe congenital neutropenia. [provided by RefSeq] |
Product Details | |
---|---|
Description | Full length Clone DNA of Human colony stimulating factor 3 receptor (granulocyte), transcript variant 1 with C terminal Myc tag. |
NCBI Ref Seq | NM_000760.2 |
RefSeq ORF Size | 2511 bp |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.