CSF3 cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

CSF3 cDNA ORF Clone, Human, N-HA tag

CSF3 cDNA ORF Clone, Human, N-HA tag

SPD-06061

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human colony stimulating factor 3 (granulocyte), transcript variant 2 with N terminal HA tag.
Target Information
Species Human
Target Name G-CSF
Gene Abbr. CSF3
Gene ID 1440
Full Name colony stimulating factor 3
Alias C17orf33, CSF3OS, GCSF
Introduction G-CSF is a pleiotropic cytokine best known for its specific effects on the proliferation, differentiation, and activation of hematopoietic cells of the neutrophilic granulocyte lineage. It is produced mainly by monocytes and macrophages upon activation by endotoxin, TNF-alpha and IFN-gamma. Other cell types including fibroblasts, endothelial cells, astrocytes and bone marrow stromal cells can also secrete G-CSF after LPS, IL-1, or TNF-alpha activation. In addition, various carcinoma cell lines and myeloblastic leukemia cells can express G-CSF constitutively.
Product Details
Description Full length Clone DNA of Human colony stimulating factor 3 (granulocyte), transcript variant 2 with N terminal HA tag.
NCBI Ref Seq NM_172219.1
RefSeq ORF Size 615 bp
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.