Online Inquiry
CSF3 cDNA ORF Clone, Human, N-FLAG tag
SPD-06048
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human colony stimulating factor 3 (granulocyte), transcript variant 1 with N terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | G-CSF |
Gene Abbr. | CSF3 |
Gene ID | 1440 |
Full Name | colony stimulating factor 3 |
Alias | C17orf33, CSF3OS, GCSF |
Introduction | G-CSF is a pleiotropic cytokine best known for its specific effects on the proliferation, differentiation, and activation of hematopoietic cells of the neutrophilic granulocyte lineage. It is produced mainly by monocytes and macrophages upon activation by endotoxin, TNF-alpha and IFN-gamma. Other cell types including fibroblasts, endothelial cells, astrocytes and bone marrow stromal cells can also secrete G-CSF after LPS, IL-1, or TNF-alpha activation. In addition, various carcinoma cell lines and myeloblastic leukemia cells can express G-CSF constitutively. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human colony stimulating factor 3 (granulocyte), transcript variant 1 with N terminal Flag tag. |
NCBI Ref Seq | NM_000759.2 |
RefSeq ORF Size | 624 bp |
Vector | pCMV3-SP-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.