Csf2 cDNA ORF Clone, Mouse, C-FLAG tag - CD BioSciences

service-banner

Csf2 cDNA ORF Clone, Mouse, C-FLAG tag

Csf2 cDNA ORF Clone, Mouse, C-FLAG tag

SPD-06141

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse colony stimulating factor 2 (granulocyte-macrophage) with C terminal Flag tag.
Target Information
Species Mouse
Target Name GM-CSF
Gene Abbr. Csf2
Gene ID 12981
Full Name colony stimulating factor 2 (granulocyte-macrophage)
Alias CSF, Csfg, Csfgm, GMCS, GMCSF
Introduction Granulocyte Macrophage Colony Stimulating Factor (also known as GM-CSF, Colony-stimulating factor; CSF, sargramostim and molgramostin) is produced in response to a number of inflammatory mediators by mesenchymal cells present in the hemopoietic environment and at peripheral sites of inflammation. Granulocyte Macrophage-CSF is able to stimulate the production of neutrophilic granulocytes, macrophages, and mixed granulocyte-macrophage colonies from bone marrow cells and can stimulate the formation of eosinophil colonies from fetal liver progenitor cells. GM-CSF can also stimulate some functional activities in mature granulocytes and macrophages. GM-CSF receptors show significant homologies with other receptors for hematopoietic growth factors, including IL2-beta, IL-3, IL-6, IL-7, EPO and the Prolactin receptors.
Product Details
Description Full length Clone DNA of Mouse colony stimulating factor 2 (granulocyte-macrophage) with C terminal Flag tag.
NCBI Ref Seq NM_009969.4
RefSeq ORF Size 426 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 0.48kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.