Online Inquiry
Csf2 cDNA ORF Clone, Human, N-HA tag
SPD-06139
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human colony stimulating factor 2(granulocyte-macrophage) with N terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | GM-CSF |
Gene Abbr. | CSF2 |
Gene ID | 1437 |
Full Name | colony stimulating factor 2 |
Alias | CSF, GMCSF |
Introduction | Granulocyte Macrophage Colony Stimulating Factor (also known as GM-CSF, Colony-stimulating factor; CSF, sargramostim and molgramostin) is produced in response to a number of inflammatory mediators by mesenchymal cells present in the hemopoietic environment and at peripheral sites of inflammation. Granulocyte Macrophage-CSF is able to stimulate the production of neutrophilic granulocytes, macrophages, and mixed granulocyte-macrophage colonies from bone marrow cells and can stimulate the formation of eosinophil colonies from fetal liver progenitor cells. GM-CSF can also stimulate some functional activities in mature granulocytes and macrophages. GM-CSF receptors show significant homologies with other receptors for hematopoietic growth factors, including IL2-beta, IL-3, IL-6, IL-7, EPO and the Prolactin receptors. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human colony stimulating factor 2(granulocyte-macrophage) with N terminal HA tag. |
RefSeq ORF Size | 435 bp |
Sequence Information | A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in E. coli system.The translated amino acid sequence is identical with NP_000749.2. |
Vector | pCMV3-SP-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Restriction Sites | KpnI + XbaI (6kb + 0.47kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.