Csf2 cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

Csf2 cDNA ORF Clone, Human, C-FLAG tag

Csf2 cDNA ORF Clone, Human, C-FLAG tag

SPD-06131

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human colony stimulating factor 2(granulocyte-macrophage) with C terminal Flag tag.
Target Information
Species Human
Target Name GM-CSF
Gene Abbr. CSF2
Gene ID 1437
Full Name colony stimulating factor 2
Alias CSF, GMCSF
Introduction Granulocyte Macrophage Colony Stimulating Factor (also known as GM-CSF, Colony-stimulating factor; CSF, sargramostim and molgramostin) is produced in response to a number of inflammatory mediators by mesenchymal cells present in the hemopoietic environment and at peripheral sites of inflammation. Granulocyte Macrophage-CSF is able to stimulate the production of neutrophilic granulocytes, macrophages, and mixed granulocyte-macrophage colonies from bone marrow cells and can stimulate the formation of eosinophil colonies from fetal liver progenitor cells. GM-CSF can also stimulate some functional activities in mature granulocytes and macrophages. GM-CSF receptors show significant homologies with other receptors for hematopoietic growth factors, including IL2-beta, IL-3, IL-6, IL-7, EPO and the Prolactin receptors.
Product Details
Description Full length Clone DNA of Human colony stimulating factor 2(granulocyte-macrophage) with C terminal Flag tag.
RefSeq ORF Size 435 bp
Sequence Information A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in E. coli system.The translated amino acid sequence is identical with NP_000749.2.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites HindIII + XbaI (6kb + 0.49kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.