Online Inquiry
CSF1R cDNA ORF Clone, Human, N-FLAG tag
SPD-10168
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human colony stimulating factor 1receptor (CSF1R) with N terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | M-CSF Receptor |
Gene Abbr. | CSF1R |
Gene ID | 1436 |
Full Name | colony stimulating factor 1 receptor |
Alias | BANDDOS, C-FMS, CD115, CSF-1R, CSFR |
Introduction | Macrophage-colony stimulating factor (M-CSF, CSF-1) receptor is an integral membrane tyrosine kinase encoded by the c-fms proto-oncogene. M-CSF receptor is expressed in monocytes (macrophages and their progenitors) and drives growth and development of this blood cell lineage.. Binding of M-CSF to its receptor induces receptor dimerization, activation, and autophosphorylation of cytoplasmic tyrosine residues used as docking sites for SH2-containing signaling proteins. There are at least five major tyrosine autophosphorylation sites. Tyr723 (Tyr721 in mouse) is located in the kinase insert (KI) region. Phosphorylated Tyr723 binds the p85 subunit of PI3 kinase as well as PLCγ2. Phosphorylation of Tyr809 provides a docking site for Shc. Overactivation of this receptor can lead to a malignant phenotype in various cell systems. The activated M-CSF receptor has been shown to be a predictor of poor outcome in advanced epithelial ovarian carcinoma and breast cancer.After initial dimerization and autophosphorylation, the CSF-1 receptor undergoes regulated intramembrane proteolysis (RIP) that involves proteolytic processing of this membrane protein and results in release of extracellular domain, intramembrane cleavage and release of the cytoplasmic domain into the cytosol. The activated intracellular domain then moves to the nucleus and regulates transcription of specific genes. It has been shown that the processing and down modulation of CSF-1 receptor is a continuous process and its rate increases substantially in response to a variety of stimuli including PMA, LPS, tumor necrosis factor, IL-2, Il-4 and its physiological ligand CSF-1. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human colony stimulating factor 1receptor (CSF1R) with N terminal Flag tag. |
NCBI Ref Seq | NM_005211.3 |
RefSeq ORF Size | 2949 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 756C/T not causing the amino acid variation. |
Vector | pCMV3-SP-N-FLAG |
Promoter | Enhanced CMV promoter |
Restriction Sites | KpnI (two restriction sites) + XbaI (6kb + 1.65kb + 1.3kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.