CSF1R cDNA ORF Clone, Canine, N-HA tag - CD BioSciences

service-banner

CSF1R cDNA ORF Clone, Canine, N-HA tag

CSF1R cDNA ORF Clone, Canine, N-HA tag

SPD-10151

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Canine colony stimulating factor 1 receptor with N terminal HA tag.
Target Information
Species Canine
Target Name M-CSF Receptor
Gene Abbr. CSF1R
Gene ID 489188
Full Name colony stimulating factor 1 receptor
Introduction Macrophage-colony stimulating factor (M-CSF, CSF-1) receptor is an integral membrane tyrosine kinase encoded by the c-fms proto-oncogene. M-CSF receptor is expressed in monocytes (macrophages and their progenitors) and drives growth and development of this blood cell lineage.. Binding of M-CSF to its receptor induces receptor dimerization, activation, and autophosphorylation of cytoplasmic tyrosine residues used as docking sites for SH2-containing signaling proteins. There are at least five major tyrosine autophosphorylation sites. Tyr723 (Tyr721 in mouse) is located in the kinase insert (KI) region. Phosphorylated Tyr723 binds the p85 subunit of PI3 kinase as well as PLCγ2. Phosphorylation of Tyr809 provides a docking site for Shc. Overactivation of this receptor can lead to a malignant phenotype in various cell systems. The activated M-CSF receptor has been shown to be a predictor of poor outcome in advanced epithelial ovarian carcinoma and breast cancer.After initial dimerization and autophosphorylation, the CSF-1 receptor undergoes regulated intramembrane proteolysis (RIP) that involves proteolytic processing of this membrane protein and results in release of extracellular domain, intramembrane cleavage and release of the cytoplasmic domain into the cytosol. The activated intracellular domain then moves to the nucleus and regulates transcription of specific genes. It has been shown that the processing and down modulation of CSF-1 receptor is a continuous process and its rate increases substantially in response to a variety of stimuli including PMA, LPS, tumor necrosis factor, IL-2, Il-4 and its physiological ligand CSF-1.
Product Details
Description Full length Clone DNA of Canine colony stimulating factor 1 receptor with N terminal HA tag.
NCBI Ref Seq XM_546306.3
RefSeq ORF Size 2904 bp
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.