Online Inquiry
CRTC2 cDNA ORF Clone, Human, N-HA tag
SPD-03991
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human CREB regulated transcription coactivator 2 with N terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | CRTC2 |
Gene Abbr. | CRTC2 |
Gene ID | 200186 |
Full Name | CREB regulated transcription coactivator 2 |
Alias | TORC-2, TORC2 |
Introduction | Glucose homeostasis is regulated by hormones and cellular energy status. Elevations of blood glucose during feeding stimulate insulin release from pancreatic β-cells through a glucose sensing pathway. Feeding also stimulates release of gut hormones such as glucagon-like peptide-1 (GLP-1), which further induces insulin release, inhibits glucagon release and promotes β-cell viability. CREB-dependent transcription likely plays a role in both glucose sensing and GLP-1 signaling. The protein CRTC2 (CREB-regulated transcription coactivator 2)/TORC2 (transducer of regulated CREB activity 2) functions as a CREB co-activator (2,3) and is implicated in mediating the effects of these two pathways. In quiescent cells, CRTC2/TORC2 is phosphorylated at Ser171 and becomes sequestered in the cytoplasm via an interaction with 14-3-3 proteins. Glucose and gut hormones lead to the dephosphorylation of CRTC2/TORC2 and its dissociation from 14-3-3 proteins. Dephosphorylated CRTC2/TORC2 enters the nucleus to promote CREB-dependent transcription. CRTC2/TORC2 plays a key role in the regulation of hepatic gluconeogenic gene transcription in response to hormonal and energy signals during fasting.CRTC2/TORC2-related proteins CRTC1/TORC1 and CRTC3/TORC3 also act as CREB co-activators. CRTC1/TORC1, CRTC2/TORC2 and CRTC3/TORC3 associate with the HTLV Tax protein to promote Tax-dependent transcription of HTLV-1 long terminal repeats. CRTC1/TORC1 is highly phosphorylated at Ser151 in mouse hypothalamic cells under basal conditions. When these cells are exposed to cAMP or a calcium activator, CRTC1/TORC1 is dephosphorylated and translocates into the nucleus. CRTC1/TORC1 is essential for energy balance and fertility. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human CREB regulated transcription coactivator 2 with N terminal HA tag. |
NCBI Ref Seq | NM_181715.1 |
RefSeq ORF Size | 2082 bp |
Vector | pCMV3-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.