CRK cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

CRK cDNA ORF Clone, Human, N-FLAG tag

CRK cDNA ORF Clone, Human, N-FLAG tag

SPD-03977

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human v-crk sarcoma virus CT10 oncogene homolog (avian) with N terminal Flag tag.
Target Information
Species Human
Target Name Crk
Gene Abbr. CRK
Gene ID 1398
Full Name CRK proto-oncogene, adaptor protein
Alias CRKII, p38
Introduction CREB is a bZIP transcription factor that activates target genes through cAMP response elements. CREB is able to mediate signals from numerous physiological stimuli, resulting in regulation of a broad array of cellular responses. While CREB is expressed in numerous tissues, it plays a large regulatory role in the nervous system. CREB is believed to play a key role in promoting neuronal survival, precursor proliferation, neurite outgrowth, and neuronal differentiation in certain neuronal populations. Additionally, CREB signaling is involved in learning and memory in several organisms. CREB is able to selectively activate numerous downstream genes through interactions with different dimerization partners. CREB is activated by phosphorylation at Ser133 by various signaling pathways including Erk, Ca2+, and stress signaling. Some of the kinases involved in phosphorylating CREB at Ser133 are p90RSK, MSK, CaMKIV, and MAPKAPK-2.
Product Details
Description Full length Clone DNA of Human v-crk sarcoma virus CT10 oncogene homolog (avian) with N terminal Flag tag.
NCBI Ref Seq NM_016823.2
RefSeq ORF Size 915 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 133A/C not causing the amino acid variation.
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 0.95kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.