Online Inquiry
CRK cDNA ORF Clone, Human, C-Myc tag
SPD-03974
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human v-crk sarcoma virus CT10 oncogene homolog (avian) with C terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Crk |
| Gene Abbr. | CRK |
| Gene ID | 1398 |
| Full Name | CRK proto-oncogene, adaptor protein |
| Alias | CRKII, p38 |
| Introduction | CREB is a bZIP transcription factor that activates target genes through cAMP response elements. CREB is able to mediate signals from numerous physiological stimuli, resulting in regulation of a broad array of cellular responses. While CREB is expressed in numerous tissues, it plays a large regulatory role in the nervous system. CREB is believed to play a key role in promoting neuronal survival, precursor proliferation, neurite outgrowth, and neuronal differentiation in certain neuronal populations. Additionally, CREB signaling is involved in learning and memory in several organisms. CREB is able to selectively activate numerous downstream genes through interactions with different dimerization partners. CREB is activated by phosphorylation at Ser133 by various signaling pathways including Erk, Ca2+, and stress signaling. Some of the kinases involved in phosphorylating CREB at Ser133 are p90RSK, MSK, CaMKIV, and MAPKAPK-2. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human v-crk sarcoma virus CT10 oncogene homolog (avian) with C terminal Myc tag. |
| NCBI Ref Seq | NM_016823.2 |
| RefSeq ORF Size | 915 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 49 A/C not causing the amino acid variation.， |
| Vector | pCMV3-C-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Restriction Sites | KpnI + XbaI (6kb + 0.96kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.