Online Inquiry
CREBBP cDNA ORF Clone, Human, untagged
SPD-02386
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human CREB binding protein |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | CBP |
| Gene Abbr. | CREBBP |
| Gene ID | 1387 |
| Full Name | CREB binding protein |
| Alias | CBP, KAT3A, MKHK1, RSTS, RSTS1 |
| Introduction | CBP (CREB-binding protein) and p300 are highly conserved and functionally related transcriptional co-activators that associate with transcriptional regulators and signaling molecules, integrating multiple signal transduction pathways with the transcriptional machinery. CBP/p300 also contain histone acetyltransferase (HAT) activity, allowing them to acetylate histones and other proteins. Phosphorylation of p300 at Ser89 by PKC represses its transciptional acitivity, and phosphorylation at the same site by AMPK disrupts the association of p300 with nuclear receptors. Ser1834 phosphorylation of p300 by Akt disrupts its association with C/EBPβ. Growth factors induce phosphorylation of CBP at Ser437, which is required for CBP recruitment to the transcription complex. CaM kinase IV phosphorylates CBP at Ser302, which is required for CBP-dependent transcriptional activation in the CNS. The role of acetylation of CBP/p300 is of particular interest. Acetylation of p300 at Lys1499 has been demonstrated to enhance its HAT activity and affect a wide variety of signaling events. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human CREB binding protein |
| NCBI Ref Seq | NM_001079846.1 |
| RefSeq ORF Size | 7215 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV mammalian cell promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 7.22kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.