Creb1 cDNA ORF Clone, Mouse, C-FLAG tag - CD BioSciences

service-banner

Creb1 cDNA ORF Clone, Mouse, C-FLAG tag

Creb1 cDNA ORF Clone, Mouse, C-FLAG tag

SPD-03911

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse cAMP responsive element binding protein 1 with C terminal Flag tag.
Target Information
Species Mouse
Target Name CREB
Gene Abbr. Creb1
Gene ID 12912
Full Name cAMP responsive element binding protein 1
Alias 2310001E10Rik, 3526402H21Rik, AV083133, Cre, Creb
Introduction CREB is a bZIP transcription factor that activates target genes through cAMP response elements. CREB is able to mediate signals from numerous physiological stimuli, resulting in regulation of a broad array of cellular responses. While CREB is expressed in numerous tissues, it plays a large regulatory role in the nervous system. CREB is believed to play a key role in promoting neuronal survival, precursor proliferation, neurite outgrowth, and neuronal differentiation in certain neuronal populations. Additionally, CREB signaling is involved in learning and memory in several organisms. CREB is able to selectively activate numerous downstream genes through interactions with different dimerization partners. CREB is activated by phosphorylation at Ser133 by various signaling pathways including Erk, Ca2+, and stress signaling. Some of the kinases involved in phosphorylating CREB at Ser133 are p90RSK, MSK, CaMKIV, and MAPKAPK-2.
Product Details
Description Full length Clone DNA of Mouse cAMP responsive element binding protein 1 with C terminal Flag tag.
NCBI Ref Seq NM_001037726.1
RefSeq ORF Size 903 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 0.9kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.