CREB1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

CREB1 cDNA ORF Clone, Human, untagged

CREB1 cDNA ORF Clone, Human, untagged

SPD-03930

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human cAMP responsive element binding protein 1, transcript variant A.
Target Information
Species Human
Target Name CREB
Gene Abbr. CREB1
Gene ID 1385
Full Name cAMP responsive element binding protein 1
Alias CREB, CREB-1
Introduction CREB is a bZIP transcription factor that activates target genes through cAMP response elements. CREB is able to mediate signals from numerous physiological stimuli, resulting in regulation of a broad array of cellular responses. While CREB is expressed in numerous tissues, it plays a large regulatory role in the nervous system. CREB is believed to play a key role in promoting neuronal survival, precursor proliferation, neurite outgrowth, and neuronal differentiation in certain neuronal populations. Additionally, CREB signaling is involved in learning and memory in several organisms. CREB is able to selectively activate numerous downstream genes through interactions with different dimerization partners. CREB is activated by phosphorylation at Ser133 by various signaling pathways including Erk, Ca2+, and stress signaling. Some of the kinases involved in phosphorylating CREB at Ser133 are p90RSK, MSK, CaMKIV, and MAPKAPK-2.
Product Details
Description Full length Clone DNA of Human cAMP responsive element binding protein 1, transcript variant A.
NCBI Ref Seq NM_004379.2
RefSeq ORF Size 984 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.