CR2 cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

CR2 cDNA ORF Clone, Human, C-FLAG tag

CR2 cDNA ORF Clone, Human, C-FLAG tag

SPD-03870

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human complement component (3d/Epstein Barr virus) receptor 2 with C terminal Flag tag.
Target Information
Species Human
Target Name CR2
Gene Abbr. CR2
Gene ID 1380
Full Name complement C3d receptor 2
Alias C3DR, CD21, CR, CVID7, SLEB9
Product Details
Description Full length Clone DNA of Human complement component (3d/Epstein Barr virus) receptor 2 with C terminal Flag tag.
NCBI Ref Seq NM_001877.3
RefSeq ORF Size 3141 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Restriction Sites HindIII (two restriction sites) + XbaI (6kb + 3.05kb + 0.11kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.