Online Inquiry
CR2 cDNA ORF Clone, Human, C-FLAG tag
SPD-03870
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human complement component (3d/Epstein Barr virus) receptor 2 with C terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | CR2 |
Gene Abbr. | CR2 |
Gene ID | 1380 |
Full Name | complement C3d receptor 2 |
Alias | C3DR, CD21, CR, CVID7, SLEB9 |
Product Details | |
---|---|
Description | Full length Clone DNA of Human complement component (3d/Epstein Barr virus) receptor 2 with C terminal Flag tag. |
NCBI Ref Seq | NM_001877.3 |
RefSeq ORF Size | 3141 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Restriction Sites | HindIII (two restriction sites) + XbaI (6kb + 3.05kb + 0.11kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.