Online Inquiry
CPT1A Knockout Cell Line
SPL-01038
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | CPT1A |
| Gene Abbr. | CPT1A |
| Gene ID | 1374 |
| Full Name | carnitine palmitoyltransferase 1A |
| Alias | CPT1, CPT1-L, L-CPT1 |
| Species | Human |
| Genomic Locus | chr11:68812520 |
| Transcript | NM_001876 |
| WT Expression Level | 40.63 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The mitochondrial oxidation of long-chain fatty acids is initiated by the sequential action of carnitine palmitoyltransferase I (which is located in the outer membrane and is detergent-labile) and carnitine palmitoyltransferase II (which is located in the inner membrane and is detergent-stable), together with a carnitine-acylcarnitine translocase. CPT I is the key enzyme in the carnitine-dependent transport across the mitochondrial inner membrane and its deficiency results in a decreased rate of fatty acid beta-oxidation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of CPT1A. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CACCACGATAAGCCAACTGG |
| PCR Primer |
Forward: CAGCAATAAAATCGGTAACTTCCCA Reverse: GAATCACTGCAGGCTGTAAACTCT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.