Online Inquiry
Cpt1a cDNA ORF Clone, Rat, N-His tag
SPD-03844
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat carnitine palmitoyltransferase 1a, liver with N terminal His tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | CPT1A |
Gene Abbr. | Cpt1a |
Gene ID | 25757 |
Full Name | carnitine palmitoyltransferase 1A |
Alias | CPT-Ia |
Introduction | Carnitine palmitoyltransferase-1 (CPT1), localized to the mitochondrial outer membrane, translocates fatty acids across the mitochondrial membranes and catalyzes the rate-limiting step of β-oxidation. There are three isoforms of this enzyme: CPT1A (liver), CPT1B (muscle), and CPT1C (brain). Deficiency of CPT1A results in an autosomal recessive mitochondrial fatty acid oxidation disorder. Studies have shown that physiological high blood glucose and insulin levels inhibit CPT1B activity in human muscle and therefore divert long-chain fatty acids toward in human muscle as triglycerides. Furthermore, mice deficient in CPT1C show less food intake and reduced body weight. These findings suggest that CPT1 may play a role in metabolic syndromes. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat carnitine palmitoyltransferase 1a, liver with N terminal His tag. |
NCBI Ref Seq | NM_031559.2 |
RefSeq ORF Size | 2322 bp |
Vector | pCMV3-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.