Cpt1a cDNA ORF Clone, Rat, C-HA tag - CD BioSciences

service-banner

Cpt1a cDNA ORF Clone, Rat, C-HA tag

Cpt1a cDNA ORF Clone, Rat, C-HA tag

SPD-03841

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat carnitine palmitoyltransferase 1a, liver with C terminal HA tag.
Target Information
Species Rat
Target Name CPT1A
Gene Abbr. Cpt1a
Gene ID 25757
Full Name carnitine palmitoyltransferase 1A
Alias CPT-Ia
Introduction Carnitine palmitoyltransferase-1 (CPT1), localized to the mitochondrial outer membrane, translocates fatty acids across the mitochondrial membranes and catalyzes the rate-limiting step of β-oxidation. There are three isoforms of this enzyme: CPT1A (liver), CPT1B (muscle), and CPT1C (brain). Deficiency of CPT1A results in an autosomal recessive mitochondrial fatty acid oxidation disorder. Studies have shown that physiological high blood glucose and insulin levels inhibit CPT1B activity in human muscle and therefore divert long-chain fatty acids toward in human muscle as triglycerides. Furthermore, mice deficient in CPT1C show less food intake and reduced body weight. These findings suggest that CPT1 may play a role in metabolic syndromes.
Product Details
Description Full length Clone DNA of Rat carnitine palmitoyltransferase 1a, liver with C terminal HA tag.
NCBI Ref Seq NM_031559.2
RefSeq ORF Size 2322 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.