Online Inquiry
COX11 Knockout Cell Line
SPL-01034
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 214bp insertion |
| Target Information | |
|---|---|
| Target Name | COX11 |
| Gene Abbr. | COX11 |
| Gene ID | 1353 |
| Full Name | cytochrome c oxidase copper chaperone COX11 |
| Alias | COX11P |
| Species | Human |
| Genomic Locus | chr17:54968397 |
| Transcript | NM_004375 |
| WT Expression Level | 26.66 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein which is not a structural subunit, but may be a heme A biosynthetic enzyme involved in COX formation, according to the yeast mutant studies. However, the studies in Rhodobacter sphaeroides suggest that this gene is not required for heme A biosynthesis, but required for stable formation of the Cu(B) and magnesium centers of COX. This human protein is predicted to contain a transmembrane domain localized in the mitochondrial inner membrane. Multiple transcript variants encoding different isoforms have been found for this gene. A related pseudogene has been found on chromosome 6. [provided by RefSeq, Jun 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 214bp insertion in a coding exon of COX11. |
| Description | 214bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GAACCCTTTCACACGCGCGC |
| PCR Primer |
Forward: AATATCGGAAACCTCTTCCACCTAC Reverse: GAGAGGGTAGAGCCGTTTCTTAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.