Online Inquiry
COQ8A Knockout Cell Line
SPL-01032
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | COQ8A |
| Gene Abbr. | COQ8A |
| Gene ID | 56997 |
| Full Name | coenzyme Q8A |
| Alias | ADCK3, ARCA2, CABC1, COQ10D4, COQ8 |
| Species | Human |
| Genomic Locus | chr1:226961514 |
| Transcript | NM_020247 |
| WT Expression Level | 11.42 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a mitochondrial protein similar to yeast ABC1, which functions in an electron-transferring membrane protein complex in the respiratory chain. It is not related to the family of ABC transporter proteins. Expression of this gene is induced by the tumor suppressor p53 and in response to DNA damage, and inhibiting its expression partially suppresses p53-induced apoptosis. Alternatively spliced transcript variants have been found; however, their full-length nature has not been determined. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of ADCK3. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCTCCACAGCCGTGGACTGC |
| PCR Primer |
Forward: GAAGGACCGTGGGACACATTAG Reverse: CTGCCATATTGGGAGACACCATC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.