Online Inquiry
COQ7 Knockout Cell Line
SPL-01029
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 46bp deletion |
| Target Information | |
|---|---|
| Target Name | COQ7 |
| Gene Abbr. | COQ7 |
| Gene ID | 10229 |
| Full Name | coenzyme Q7, hydroxylase |
| Alias | CAT5, CLK-1, CLK1, COQ10D8 |
| Species | Human |
| Genomic Locus | chr16:19072087 |
| Transcript | NM_016138 |
| WT Expression Level | 27.05 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is similar to a mitochondrial di-iron containing hydroxylase in Saccharomyces cerevisiae that is involved with ubiquinone biosynthesis. Mutations in the yeast gene lead to slower development and longer life span. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 46bp deletion in a coding exon of COQ7. |
| Description | 46bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTGAATGACTGGCCCGACGC |
| PCR Primer |
Forward: AACACTTGCATTTCAGCTTATGGAA Reverse: CTCTTGGGATACAATACCTCTCTGG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.