Online Inquiry
COPS7A Knockout Cell Line
SPL-01024
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 25bp deletion |
| Target Information | |
|---|---|
| Target Name | COPS7A |
| Gene Abbr. | COPS7A |
| Gene ID | 50813 |
| Full Name | COP9 signalosome subunit 7A |
| Alias | CSN7, CSN7A, SGN7a |
| Species | Human |
| Genomic Locus | chr12:6724765 |
| Transcript | NM_001164094 |
| WT Expression Level | 53.08 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a component of the COP9 signalosome, an evolutionarily conserved multi-subunit protease that regulates the activity of the ubiquitin conjugation pathway. Alternatively spliced transcript variants that encode the same protein have been described. [provided by RefSeq, Mar 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 25bp deletion in a coding exon of COPS7A. |
| Description | 25bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCCCCTGGTGTCTACGTGTT |
| PCR Primer |
Forward: CTCTAGCTTCACATCCTCTTTCCTT Reverse: TGGTTATTGGATCACAAAATGAGCC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.