Online Inquiry
COMT Knockout Cell Line
SPL-01022
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 148bp deletion |
| Target Information | |
|---|---|
| Target Name | COMT |
| Gene Abbr. | COMT |
| Gene ID | 1312 |
| Full Name | catechol-O-methyltransferase |
| Alias | HEL-S-98n |
| Species | Human |
| Genomic Locus | chr22:19963711 |
| Transcript | NM_000754 |
| WT Expression Level | 36.10 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Catechol-O-methyltransferase catalyzes the transfer of a methyl group from S-adenosylmethionine to catecholamines, including the neurotransmitters dopamine, epinephrine, and norepinephrine. This O-methylation results in one of the major degradative pathways of the catecholamine transmitters. In addition to its role in the metabolism of endogenous substances, COMT is important in the metabolism of catechol drugs used in the treatment of hypertension, asthma, and Parkinson disease. COMT is found in two forms in tissues, a soluble form (S-COMT) and a membrane-bound form (MB-COMT). The differences between S-COMT and MB-COMT reside within the N-termini. Several transcript variants are formed through the use of alternative translation initiation sites and promoters. [provided by RefSeq, Sep 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 148bp deletion in a coding exon of COMT. |
| Description | 148bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGCCGCCATCACCCAGCGGA |
| PCR Primer |
Forward: GGAAGGGTGGAAAAGATAGGGAC Reverse: GTGATAGTGGGTTTTCAGTGAACG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.