Online Inquiry
CNST Knockout Cell Line
SPL-01013
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 14bp deletion |
| Target Information | |
|---|---|
| Target Name | CNST |
| Gene Abbr. | CNST |
| Gene ID | 163882 |
| Full Name | consortin, connexin sorting protein |
| Alias | C1orf71, PPP1R64 |
| Species | Human |
| Genomic Locus | chr1:246591715 |
| Transcript | NM_152609 |
| WT Expression Level | 6.76 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Targeting of numerous transmembrane proteins to the cell surface is thought to depend on their recognition by cargo receptors that interact with the adaptor machinery for anterograde traffic at the distal end of the Golgi complex. Consortin (CNST) is an integral membrane protein that acts as a binding partner of connexins, the building blocks of gap junctions, and acts as a trans-Golgi network (TGN) receptor involved in connexin targeting to the plasma membrane and recycling from the cell surface (del Castillo et al., 2010 [PubMed 19864490]).[supplied by OMIM, Jun 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of CNST. |
| Description | 14bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GACCAGCAGTGACAGTGCGA |
| PCR Primer |
Forward: TTAAATGGTTCACCAAAGGATGCTC Reverse: TTGCTTCTTGGACTTCTTTTTCCAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.