Online Inquiry
CNR1 Knockout Cell Line
SPL-01011
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 25bp deletion |
| Target Information | |
|---|---|
| Target Name | Cannabinoid Receptor |
| Gene Abbr. | CNR1 |
| Gene ID | 1268 |
| Full Name | cannabinoid receptor 1 |
| Alias | CANN6, CB-R, CB1, CB1A, CB1K5 |
| Species | Human |
| Genomic Locus | chr6:88144899 |
| Transcript | NM_016083 |
| WT Expression Level | 3.03 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes one of two cannabinoid receptors. The cannabinoids, principally delta-9-tetrahydrocannabinol and synthetic analogs, are psychoactive ingredients of marijuana. The cannabinoid receptors are members of the guanine-nucleotide-binding protein (G-protein) coupled receptor family, which inhibit adenylate cyclase activity in a dose-dependent, stereoselective and pertussis toxin-sensitive manner. The two receptors have been found to be involved in the cannabinoid-induced CNS effects (including alterations in mood and cognition) experienced by users of marijuana. Multiple transcript variants encoding two different protein isoforms have been described for this gene. [provided by RefSeq, May 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 25bp deletion in a coding exon of CNR1. |
| Description | 25bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGCAGTCCTGTCCCTCACGC |
| PCR Primer |
Forward: AAGCTGTAGACAAAAATGACACTCC Reverse: CCCACAGAAATTCCCTTTAACTTCC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.