Online Inquiry
CNKSR2 Knockout Cell Line
SPL-01007
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
8bp deletion |
Target Information | |
---|---|
Target Name | CNKSR2 |
Gene Abbr. | CNKSR2 |
Gene ID | 22866 |
Full Name | connector enhancer of kinase suppressor of Ras 2 |
Alias | CNK2, KSR2, MAGUIN, MRXSHG |
Species | Human |
Genomic Locus | chrX:21426561 |
Transcript | NM_001168647 |
WT Expression Level | 0.07 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a multidomain protein that functions as a scaffold protein to mediate the mitogen-activated protein kinase pathways downstream from Ras. This gene product is induced by vitamin D and inhibits apoptosis in certain cancer cells. It may also play a role in ternary complex assembly of synaptic proteins at the postsynaptic membrane and coupling of signal transduction to membrane/cytoskeletal remodeling. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of CNKSR2. |
Description | 8bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | GCTGCTGCGCATTACACATC |
PCR Primer |
Forward: CCCACCCTTCACATTTATTTGGTTT Reverse: CAGCTGGTTGAGAATCAGAGTTTTT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.