CLTA cDNA ORF Clone, Rabbit, untagged - CD BioSciences

service-banner

CLTA cDNA ORF Clone, Rabbit, untagged

CLTA cDNA ORF Clone, Rabbit, untagged

SPD-03542

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rabbit clathrin, light polypeptide A.
Target Information
Species Rabbit
Target Name CLTA
Gene Abbr. CLTA
Gene ID 100350456
Full Name clathrin light chain A
Product Details
Description Full length Clone DNA of Rabbit clathrin, light polypeptide A.
NCBI Ref Seq XM_002707986.1
RefSeq ORF Size 711 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.